Streaming RNA-seq data from ENA
For many of the projects I’m working on for my PhD I use published data. Up until now my strategy has been to download all read files of an experiment from ENA, then process them all with e.g. Salmon to get expression values. This feels a bit silly because sequencing read files are on the order of gigabytes in size, while a csv file of expression values is a few megabytes. In fact, currently my data directory has almost 50 terabytes of public data in it.
The other day I saw this gist
from Mike Love. Supposedly it gives you the
URL of a ftp hosted fastq from the ENA/SRA accession number of it. This is
great, because you can just use curl
on the URL, which by defualt streams a
file in chunks, to fetch the contents of a sequencing read data set.
We only need to know the name of it.
I made a small Bash script for streaming a given accession id.
#/bin/bash
fastq="$1"
prefix=ftp://ftp.sra.ebi.ac.uk/vol1/fastq
accession=$(echo $fastq | tr '.' '_' | cut -d'_' -f 1)
dir1=${accession:0:6}
a_len=${#accession}
if (( $a_len == 9 )); then
dir2="";
elif (( $a_len == 10 )); then
dir2=00${accession:9:1};
elif (( $a_len == 11)); then
dir2=0${accession:9:2};
else
dir2=${accession:9:3};
fi
url=$prefix/$dir1/$dir2/$accession/$fastq.gz
curl --keepalive-time 4 -s $url | zcat
We call this file stream_ena
. You need to know the id of accession, and
whether the file you want to look at is part of a pair. But then you have
instant access to the contents of any published sequencing data-set!
If we want to look at some single-end data, we can just do
$ ./stream_ena SRR3185782.fastq | head
@SRR3185782.1 HWI-D00361:180:HJG3GADXX:2:1101:1460:2181/1
AGTGTGTTCATCAGTGTGGATTTGCCAATGCCGGTCTCCCCCACACAGAG
+
BBBFFBFFFB<FFFFFBFF<FFFFFFFFFFFFFIIIIFFFFFFFFIFFFF
@SRR3185782.2 HWI-D00361:180:HJG3GADXX:2:1101:1613:2218/1
GCCAATTTTCTTAATGTAAGTGCTGACTTCCTTAACAATTTCCTCATATC
+
BBBFFFFFFFFFFIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
@SRR3185782.3 HWI-D00361:180:HJG3GADXX:2:1101:2089:2243/1
CGGGTTCTTGGACTTCAGCCAGTTGAGCAGGGCATCCTTGTTGAAGGCGG
If we want to quantify this data set with salmon, we can now simply run
$ salmon quant -l IU \
-i Homo_sapiens.GRCh38.78.cdna_ERCC_repbase.fa \
-r <(./stream_ena SRR3185782.fastq) -o SRR3185782
This will stream the entire contents of accession in to salmon directly from
ENA without storing anything on disk, and quantified expression will be saved
in the directory SRR3185782
.
For a dataset with paired reads we would do for example
$ salmon quant -l IU \
-i Homo_sapiens.GRCh38.78.cdna_ERCC_repbase.fa \
-1 <(./stream_ena SRR1274127_1.fastq) \
-2 <(./stream_ena SRR1274127_2.fastq) -o SRR1274127
Many sequencing tools supports streaming out box don care whether you are your
disk or server online.
Say for example we want to look at 5 random reads:
$ seqtk sample -s $(date +%s) <(./stream_ena SRR1274127_1.fastq) 0.001 | head -n 20
@SRR1274127.753 753/1
TTAGAAGGATTATGGATGCGGTTGCTTGCGTGAGGAAATACTTGATGGCAGCTTCTGTGGAACGAGGGTTTATTTTTTTGGGTAGAACTGGAATAAAAGCT
+
BCCFFFFFHHHHHJJJJJJJJHIJIJJJIICGHIJGIJJIJJJJJJJJJJJJJJJJJIJJJGHHFFFD;ADDDDEEDDDD>&2>?ACDDDCDDDDDDDDDC
@SRR1274127.1464 1464/1
AATCAATACTCATCATTAATAATCATAATGGCTATAGCAATAAAACTAGGAATAGCCCCCTTTCACTTCTGAGTCCCAGAGGTTACCCAAGGCACCCCTCT
+
CCCFFFFFHHHHHJJIIHIIJJIJJIGJGJJJJJJJJJJJJJJJJJJJJJJJJJJFIIJJJJJJIJJIIJJIIIJJHHHHFFDFFFFEEDDDDDDB@BBB9
@SRR1274127.1672 1672/1
CCCTACTACTATCTCGCACCTGAAACACCCTAACATGACTAACACCCTTAATTCCATCCACCCTCCTCTCCCTAGGAGGCCTGCCCCCGCTAACCGGCTTT
+
@@@DDDD>FABBD@BDFB:FE;+2+2<)):CFB?<3?4?B*99???FFFE98)>F;778)7(5@E1CF?DDB#############################
@SRR1274127.2188 2188/1
GATTATTAGGGGAACTAGTCAGTTGCCAAAGCCTCCGATTATGATGGGTATTACTATGAAGAAGATTATTACAAATGCATGGGCTGTGACGATAACGTTGT
+
@?@DFDEDFBHFHGGG@DCHEEHG@FEHG@HGGGGIID=FDHGGHGCG?8?CFHHGHGAHEACHA@E<D@EFE>??C@@CD@B@AABCCC@BB@BCB9992
@SRR1274127.4127 4127/1
CTTATACTAGTATCCTTAATCATTTTTATTGCCACAACTAACCTCCTCGGACTCCTGCCTCACTCATTTACACCAACCACCCAACTATCTATAAACCTAGC
+
??@DDFFFDHFFDGHGGGGGHEGGJEHIIAFDGIIGGIJGIGHHIJJIAFBGIGHJGEGIGGJGGGI=EGEEECHAB<?ACB?ABCCDDDDDDCCDDCDCD
Or if we want to check the quality of a dataset without wasting space downloading it:
$ ./stream_ena SRR1274127_1.fastq | fastqc -o SRR1274127_1_fastqc -f fastq stdin
Of course there are caveats.
You can’t just blindly put any reads in to salmon and get correct expression.
You need to read the methods section of the related study to see what parameters use.
The data might need some might preprocessing before it is useful.
It is also very common that files uploaded to ENA
should be merged before being input to processing tools. But this streaming
approach greatly ease storage
burden burden from working with public data.